| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.042462 |
| Chromosome: | chromosome 13 |
| Location: | 3563329 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g588201 | RAP6,OPR58 | OctotricoPeptide Repeat protein 58; (1 of 19) PTHR21228//PTHR21228:SF20 - FAST LEU-RICH DOMAIN-CONTAINING // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCCAGATTGATGCGCACCGCCTCCGGAC |
| Internal bar code: | GCGTGATCCAAGGGACGAGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1404 |
| LEAP-Seq percent confirming: | 3.98323 |
| LEAP-Seq n confirming: | 589 |
| LEAP-Seq n nonconfirming: | 14198 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCTCGTGTACCCTCCTCT |
| Suggested primer 2: | GAGCTGTTCACCTCCGTTTC |