| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.042481 |
| Chromosome: | chromosome 3 |
| Location: | 3566088 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g168150 | (1 of 2) PF00069//PF12796 - Protein kinase domain (Pkinase) // Ankyrin repeats (3 copies) (Ank_2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCTCCACTCCACACCCAGCGCTAATGCG |
| Internal bar code: | CCTGTAAACGCCAGAGCCGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 887 |
| LEAP-Seq percent confirming: | 99.2343 |
| LEAP-Seq n confirming: | 4536 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGACATGCCAAACAAGTG |
| Suggested primer 2: | GACATTACGCTGGGGTCTGT |