| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.042559 |
| Chromosome: | chromosome 5 |
| Location: | 1524028 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g243600 | GOX2 | Glyoxal or galactose oxidase pseudogene; (1 of 1) IPR013783//IPR014756//IPR015202 - Immunoglobulin-like fold // Immunoglobulin E-set // Domain of unknown function DUF1929 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGACGTGTACAGCAGTGCGGTGTAGGTGC |
| Internal bar code: | CGGATCGTGCCCGGGCAGCGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 967 |
| LEAP-Seq percent confirming: | 97.3809 |
| LEAP-Seq n confirming: | 8217 |
| LEAP-Seq n nonconfirming: | 221 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTGTGTTGCACCCTAGCA |
| Suggested primer 2: | CTACTCGGGCAGGTCTCAAG |