| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.042618 |
| Chromosome: | chromosome 16 |
| Location: | 2205833 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g658600 | SPC25, SPCB25 | (1 of 1) K11550 - kinetochore protein Spc25, animal type (SPBC25, SPC25); Putative kinetochore protein Spc25 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAAAGGTGGCTCTCCCTGTCAAGCGGTAA |
| Internal bar code: | TCCTGGTCGCCCCACCCGGAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 605 |
| LEAP-Seq percent confirming: | 99.8008 |
| LEAP-Seq n confirming: | 9016 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACCGACAACGTCTACAGC |
| Suggested primer 2: | TGCTGTAGCGAGGATTTGTG |