| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.042656 |
| Chromosome: | chromosome 7 |
| Location: | 5314074 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g349650 | (1 of 8) 2.3.1.75 - Long-chain-alcohol O-fatty-acyltransferase / Wax synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCCAAATCAATCGAGAAGCGCGGAACGC |
| Internal bar code: | GAGCGGAAAATTCGCTGGCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 354 |
| LEAP-Seq percent confirming: | 76.2067 |
| LEAP-Seq n confirming: | 1784 |
| LEAP-Seq n nonconfirming: | 557 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAAGCCTTCGGAAAGAGAA |
| Suggested primer 2: | CTCCGCCCAGTCTACTCTTG |