Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.042672 |
Chromosome: | chromosome 3 |
Location: | 5837977 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g189250 | RAB11,RABA1 | Small Rab-related GTPase; (1 of 1) K07904 - Ras-related protein Rab-11A (RAB11A) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATTCGGGTACGCTCTCGCAACATCTGTA |
Internal bar code: | GTTTCGAATCGGCCCGGGTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 938 |
LEAP-Seq percent confirming: | 94.0853 |
LEAP-Seq n confirming: | 3595 |
LEAP-Seq n nonconfirming: | 226 |
LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTATATGTGGTGCGTGCTGG |
Suggested primer 2: | ATCGTCAGCAAGAAGGTGCT |