| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.042844 |
| Chromosome: | chromosome 10 |
| Location: | 1575011 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g429250 | (1 of 3) 2.7.11.25//2.7.12.1 - Mitogen-activated protein kinase kinase kinase / MLTK // Dual-specificity kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGGAGCGCAGCCCCGCCAACACCGACGG |
| Internal bar code: | ACGGTGGAACGGTCAGGCCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 981 |
| LEAP-Seq percent confirming: | 99.0658 |
| LEAP-Seq n confirming: | 7635 |
| LEAP-Seq n nonconfirming: | 72 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTCCCAGTACGGCTCCTTT |
| Suggested primer 2: | CGGGTGCTATACCGTTGACT |