| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.042866 |
| Chromosome: | chromosome 6 |
| Location: | 1273669 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g258200 | (1 of 1) PF00004//PF13771 - ATPase family associated with various cellular activities (AAA) (AAA) // PHD-like zinc-binding domain (zf-HC5HC2H) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGTCTGGACGAGGAAGACGAGCCGGAGG |
| Internal bar code: | TGAGTGTAGCCAATTCAGCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 82 |
| LEAP-Seq percent confirming: | 99.0526 |
| LEAP-Seq n confirming: | 941 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGATGTGGACATGGAGGAG |
| Suggested primer 2: | TTGATCGTGTGTATGCTGGC |