Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.042987 |
Chromosome: | chromosome 17 |
Location: | 2630855 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g717200 | (1 of 1) PTHR10060:SF24 - DEOXYRIBONUCLEASE TATDN3-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGTGTGCCTAGTGAGAGGTGGCTGCATC |
Internal bar code: | GGCCGACCTAACGGCTCATTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 546 |
LEAP-Seq percent confirming: | 99.4431 |
LEAP-Seq n confirming: | 8749 |
LEAP-Seq n nonconfirming: | 49 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTGTTGTTTTGGAGTCCCG |
Suggested primer 2: | TCATTATCAGGAAGCCCACC |