| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.042991 |
| Chromosome: | chromosome 2 |
| Location: | 5649794 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g109600 | INM1,IPP3 | Inositol monophosphatase; (1 of 2) K01092 - myo-inositol-1(or 4)-monophosphatase (E3.1.3.25, IMPA, suhB) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGGGCAGTGCGTGAGGCAGAGGACACAG |
| Internal bar code: | GGGGTCGGGTAGGTGTTGCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 692 |
| LEAP-Seq percent confirming: | 99.1799 |
| LEAP-Seq n confirming: | 1935 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCCATTCACTTGTGTGTTG |
| Suggested primer 2: | GTAGAGCTGGGGCTGCTATG |