| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.043054 |
| Chromosome: | chromosome 1 |
| Location: | 2483842 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g014050 | (1 of 1) PF16543 - DRG Family Regulatory Proteins, Tma46 (DFRP_C) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTGCGCCCCCGCTTTGCCCACATTGGGT |
| Internal bar code: | ATCGCATAGCGGTACTGAGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 495 |
| LEAP-Seq percent confirming: | 73.2451 |
| LEAP-Seq n confirming: | 3266 |
| LEAP-Seq n nonconfirming: | 1193 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGGGACAATCAAGGGAAG |
| Suggested primer 2: | GAGCTGTTCGATGACGATGA |