| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.043139 |
| Chromosome: | chromosome 13 |
| Location: | 1122269 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g569450 | (1 of 1) IPR000104//IPR029058 - Antifreeze protein, type I // Alpha/Beta hydrolase fold | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTGCGTGATCAGGTGCCCGCCCTCCAGT |
| Internal bar code: | TCTAACGAGATCCGAGGCGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 678 |
| LEAP-Seq percent confirming: | 83.0189 |
| LEAP-Seq n confirming: | 2860 |
| LEAP-Seq n nonconfirming: | 585 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACAGCCGTAGATGCCATA |
| Suggested primer 2: | TTGCCCTTAACAACCACACA |