Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.043139 |
Chromosome: | chromosome 13 |
Location: | 1122275 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g569450 | (1 of 1) IPR000104//IPR029058 - Antifreeze protein, type I // Alpha/Beta hydrolase fold | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTGCTGGTGCTCCCGCCCAGTGCCCGCG |
Internal bar code: | GATCAGCGTGGGACGGCGTGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 673 |
LEAP-Seq percent confirming: | 98.6182 |
LEAP-Seq n confirming: | 8279 |
LEAP-Seq n nonconfirming: | 116 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCACAGCCGTAGATGCCATA |
Suggested primer 2: | TTGCCCTTAACAACCACACA |