| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.043188 |
| Chromosome: | chromosome 13 |
| Location: | 4653007 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g604250 | (1 of 1) IPR002889//IPR003882//IPR013994 - Carbohydrate-binding WSC // Pistil-specific extensin-like protein // Carbohydrate-binding WSC, subgroup | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACCAAAACTATCAAGGTCCATTCGCTTG |
| Internal bar code: | GCAGCTCCCGTATCTGTAGCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 526 |
| LEAP-Seq percent confirming: | 98.0 |
| LEAP-Seq n confirming: | 147 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAAAGATGATGCGGCGATT |
| Suggested primer 2: | ACACCTGCTACCTGTGGGAC |