| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.043200 |
| Chromosome: | chromosome 9 |
| Location: | 3173638 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g387245 | STT3A | Staurosporin and temperature sensitive 3-like A; (1 of 1) PTHR13872//PTHR13872:SF1 - 60S RIBOSOMAL PROTEIN L35 // DOLICHYL-DIPHOSPHOOLIGOSACCHARIDE--PROTEIN GLYCOSYLTRANSFERASE SUBUNIT STT3B | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCCGCCCAACCCACGGCCATCACCTAAT |
| Internal bar code: | CCCGGTGCGTGATCGAAGCTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 183 |
| LEAP-Seq percent confirming: | 99.5014 |
| LEAP-Seq n confirming: | 2195 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCCCTGTACCAATGTGCT |
| Suggested primer 2: | GCAGTCACCTTCTTGCATCA |