| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.043212 |
| Chromosome: | chromosome 14 |
| Location: | 241712 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g609250 | (1 of 1) PF13839 - GDSL/SGNH-like Acyl-Esterase family found in Pmr5 and Cas1p (PC-Esterase) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCACACTCCACTCCACTGCATGCGCACGC |
| Internal bar code: | GTCTGTGGCTTTTTTTCGTCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 400 |
| LEAP-Seq percent confirming: | 82.5 |
| LEAP-Seq n confirming: | 297 |
| LEAP-Seq n nonconfirming: | 63 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCGTGTGGACACTAATCCC |
| Suggested primer 2: | TCATGACAGCAGGTGCTAGG |