Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.043307 |
Chromosome: | chromosome 7 |
Location: | 1441668 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g323150 | TEH4 | (1 of 1) K17362 - acyl-coenzyme A thioesterase 13 [EC:3.1.2.-] (ACOT13); Thioesterase-like protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGAGCTGCAGAAGGCATGAGACCACGGG |
Internal bar code: | GGTCATAGGGAGACTCGAACGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 842 |
LEAP-Seq percent confirming: | 99.6109 |
LEAP-Seq n confirming: | 4352 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACGGGCTTGAGACTTGAGA |
Suggested primer 2: | AACTTGGACGACGGTGTAGG |