Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.043373 |
Chromosome: | chromosome 14 |
Location: | 797992 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g613050 | (1 of 80) IPR003882 - Pistil-specific extensin-like protein | intron|outside_mRNA | |
Cre14.g613075 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTGACCCCTCCAAGTCCATCGGTCCTTC |
Internal bar code: | CGGGGCGAAGAGAGGCGAACCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 626 |
LEAP-Seq percent confirming: | 98.983 |
LEAP-Seq n confirming: | 1168 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAACTTACGTTCGTGGCAT |
Suggested primer 2: | GGCGGTAGTTGATTGATGCT |