| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.043390 |
| Chromosome: | chromosome 6 |
| Location: | 8550212 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g308300 | RRM6 | (1 of 2) IPR002877//IPR029063 - Ribosomal RNA methyltransferase FtsJ domain // S-adenosyl-L-methionine-dependent methyltransferase; Putative ribosomal RNA methyltransferase of the RrmJ/FtsJ family | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGCACGTTGGCGAAGATGCGGCCGCAGG |
| Internal bar code: | GTGACGTACGGGACTCACGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 210 |
| LEAP-Seq percent confirming: | 99.8907 |
| LEAP-Seq n confirming: | 1828 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTGGGTAAGACGCTTGGT |
| Suggested primer 2: | CCATTGCTCTCTGTAACGCA |