| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.043441 |
| Chromosome: | chromosome 17 |
| Location: | 2960105 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g720050 | FTSH2,FHL2 | (1 of 1) PTHR23076:SF72 - ATP-DEPENDENT ZINC METALLOPROTEASE FTSH 2, CHLOROPLASTIC-RELATED; membrane AAA-metalloprotease, chloroplast | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAAGGTCAGGGCCGCAGGGCCGTATACGA |
| Internal bar code: | GAGAAATATTCACGAGTGTACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 342 |
| LEAP-Seq percent confirming: | 99.56 |
| LEAP-Seq n confirming: | 905 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGATCAACCGTACTAGGGCA |
| Suggested primer 2: | TGCAGAAGGTGACTCTGGTG |