Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.043451 |
Chromosome: | chromosome 3 |
Location: | 5155741 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g182200 | (1 of 1) IPR001054//IPR028082//IPR029787 - Adenylyl cyclase class-3/4/guanylyl cyclase // Periplasmic binding protein-like I // Nucleotide cyclase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCAGGGCACTGCACGCCAGCACGACCGAC |
Internal bar code: | TGGACACTCCCATCGGGGGGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 710 |
LEAP-Seq percent confirming: | 99.6757 |
LEAP-Seq n confirming: | 4611 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGTATCATCAGCACGTGGG |
Suggested primer 2: | TCGCGATCTCAGGTACAGTG |