Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.043498 |
Chromosome: | chromosome 2 |
Location: | 7318825 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g145250 | RPS27-B,RPS27E2,RPS27e2 | (1 of 2) K02978 - small subunit ribosomal protein S27e (RP-S27e, RPS27); Cytosolic 80S ribosomal protein S27, isoform B | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACCGCAACGAGCATGTAGGGTCCGTGGC |
Internal bar code: | CATATCACTGGAGGCTTAGTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 717 |
LEAP-Seq percent confirming: | 89.456 |
LEAP-Seq n confirming: | 1332 |
LEAP-Seq n nonconfirming: | 157 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGTGTGAGGATGCAGCTA |
Suggested primer 2: | AGGTGCGTTGAGGCTACAGT |