Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.043517 |
Chromosome: | chromosome 14 |
Location: | 543776 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g611552 | TGL22 | (1 of 32) 3.1.1.3 - Triacylglycerol lipase / Triglyceride lipase; Putative triacylglycerol lipase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCGTGTTGGCCCCAGAGTCGGGAAATAG |
Internal bar code: | CGAACCTATTCCGTCCTTATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 545 |
LEAP-Seq percent confirming: | 72.4892 |
LEAP-Seq n confirming: | 8719 |
LEAP-Seq n nonconfirming: | 3309 |
LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAGACCACCTGGTGTACCT |
Suggested primer 2: | TTTGCGGCAGTCACTATCAG |