Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.043614 |
Chromosome: | chromosome 13 |
Location: | 940508 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g568100 | (1 of 4) 3.4.21.19 - Glutamyl endopeptidase / V8 proteinase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCTCATCCCCGCACACACAGGCTCGCGC |
Internal bar code: | CAGGTCTTAGGGCACTTTATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1109 |
LEAP-Seq percent confirming: | 99.1968 |
LEAP-Seq n confirming: | 13092 |
LEAP-Seq n nonconfirming: | 106 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCACACCTTGCTTTATGGGT |
Suggested primer 2: | GGTCATGCGTAGGGTGAAGT |