| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.043671 |
| Chromosome: | chromosome 14 |
| Location: | 4077684 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g633750 | IPB2 | (1 of 1) PTHR10527:SF5 - FI07923P; Importin beta-3 homolog | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGATAGGCCCCATAAAGGGAAAGACAAGA |
| Internal bar code: | ACGGGGTGGCAGGAACGACTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 694 |
| LEAP-Seq percent confirming: | 99.5508 |
| LEAP-Seq n confirming: | 1773 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAACTAAACCGGGGCACTA |
| Suggested primer 2: | ACGAATCGAGAGATCGCACT |