| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.043674 |
| Chromosome: | chromosome 2 |
| Location: | 7882568 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g141600 | EBM3 | (1 of 9) 3.2.1.78 - Mannan endo-1,4-beta-mannosidase / Endo-1,4-mannanase; Mannan endo-1%252C4-beta-mannosidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCCAGTCACGGCTACAGCCTTTGGATCA |
| Internal bar code: | CAACTCCTGTTTAAACAAGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 461 |
| LEAP-Seq percent confirming: | 98.2274 |
| LEAP-Seq n confirming: | 2937 |
| LEAP-Seq n nonconfirming: | 53 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTCACACTCGCACACCTA |
| Suggested primer 2: | TATCTAGCAGGGAGGCTGGA |