| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.043692 |
| Chromosome: | chromosome 10 |
| Location: | 6527082 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g466850 | FKB18 | (1 of 2) PTHR10516//PTHR10516:SF281 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE // 12 KDA FK506-BINDING PROTEIN; peptidyl-prolyl cis-trans isomerase, FKBP-type | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTATATAATTGTAGGGTAGCATTGAGCCC |
| Internal bar code: | ATATACCGCACGCCATCCGATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 257 |
| LEAP-Seq percent confirming: | 51.2472 |
| LEAP-Seq n confirming: | 3924 |
| LEAP-Seq n nonconfirming: | 3733 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGTAGGTGTAACCGCACG |
| Suggested primer 2: | TACATCACGCCACCATGACT |