| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.043716 |
| Chromosome: | chromosome 10 |
| Location: | 483840 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g421021 | (1 of 25) IPR001005//IPR009057//IPR017930 - SANT/Myb domain // Homeodomain-like // Myb domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTGATCATGGCACATGCAGGCGTGCGTG |
| Internal bar code: | ACAGCCGCGGGGTGGAATTCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 900 |
| LEAP-Seq percent confirming: | 99.5592 |
| LEAP-Seq n confirming: | 12197 |
| LEAP-Seq n nonconfirming: | 54 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCACGAGCTAGCCATCTT |
| Suggested primer 2: | GAACGATATTGCAGCACGAA |