| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.043759 |
| Chromosome: | chromosome 3 |
| Location: | 654043 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g145827 | subtilisin-like Type II membrane endoprotease; (1 of 1) IPR000209//IPR003882//IPR015500 - Peptidase S8/S53 domain // Pistil-specific extensin-like protein // Peptidase S8, subtilisin-related | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTCCATCTCGTACCAGCCTGCGGCCGTG |
| Internal bar code: | AGGGCTGCCAGAACAGCTGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 600 |
| LEAP-Seq percent confirming: | 98.181 |
| LEAP-Seq n confirming: | 2267 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTCTCCCCCTTGTGATCT |
| Suggested primer 2: | TTTGAGGGCTTCAAGTACGG |