Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.043792 |
Chromosome: | chromosome 2 |
Location: | 7525035 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g144006 | (1 of 17) PF13833 - EF-hand domain pair (EF-hand_8) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGTGAAGGTGGCGGTGGTGGTGTAGGTC |
Internal bar code: | TAGTCCCCGGTCGGCAGATGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 336 |
LEAP-Seq percent confirming: | 86.1996 |
LEAP-Seq n confirming: | 812 |
LEAP-Seq n nonconfirming: | 130 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACACACACGGACGTAATGC |
Suggested primer 2: | CACCAATACTGGCACTGTGG |