| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.043804 |
| Chromosome: | chromosome 3 |
| Location: | 589937 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g145547 | CBR1 | (1 of 3) K00326 - cytochrome-b5 reductase (E1.6.2.2); NADH-cytochrome b5 reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCACTGGGCGCCGGGAACTTGGTGCGGA |
| Internal bar code: | AAGACATCGAAGGCGGGAGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 752 |
| LEAP-Seq percent confirming: | 97.7273 |
| LEAP-Seq n confirming: | 430 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGCATCTTGTTGCAGGAC |
| Suggested primer 2: | GGCAGAAGCACAGAGTGTGA |