| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.043859 |
| Chromosome: | chromosome 17 |
| Location: | 746361 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g701250 | FLA12,PF8,CCDC39,FAP59 | Flagellar Associated Protein 59; (1 of 1) PTHR18962//PTHR18962:SF0 - FAMILY NOT NAMED // COILED-COIL DOMAIN-CONTAINING PROTEIN 39 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGCCCGCCGCCTCACACGCCTCCGCAAT |
| Internal bar code: | GTAGGATTTTTAGTTGGGGACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 296 |
| LEAP-Seq percent confirming: | 80.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACACACACACCG |
| Suggested primer 2: | CGCCGAATCCAAATTACTGT |