| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.043871 |
| Chromosome: | chromosome 1 |
| Location: | 6858636 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g049600 | CGLD22 | (1 of 1) K02116 - ATP synthase protein I (atpI); Assembly factor for chloroplast ATPase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGGGGCCAATTGTGTATTGGCTCGAGGG |
| Internal bar code: | TCGGTTCATTTTTTCTCAACCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1259 |
| LEAP-Seq percent confirming: | 99.2908 |
| LEAP-Seq n confirming: | 140 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGCAAGCAACTGAAGGAAA |
| Suggested primer 2: | TGTGTTTGATGGCAACCTGT |