Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.043964 |
Chromosome: | chromosome 5 |
Location: | 347188 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g233303 | (1 of 1) K11718 - UDP-glucose:glycoprotein glucosyltransferase (HUGT) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGCGGCGGCAGTGAAGGGGGCGTCGGGG |
Internal bar code: | GCTTCTCCCCCATTCATGGCAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 87 |
LEAP-Seq percent confirming: | 95.1219 |
LEAP-Seq n confirming: | 117 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGTCCTTGTTGCCCTTGT |
Suggested primer 2: | CCCAAACTAAACCAAAGCCA |