| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.043982 |
| Chromosome: | chromosome 13 |
| Location: | 1234150 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g570350 | AKC4 | (1 of 1) PTHR10566//PTHR10566:SF74 - CHAPERONE-ACTIVITY OF BC1 COMPLEX CABC1 -RELATED // ABC TRANSPORTER-LIKE; conserved expressed ABC-1 like kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTGGGAAACGGTTACTACCCCGCACGGA |
| Internal bar code: | CGTCCGTCGCGTGGCGTTTCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 612 |
| LEAP-Seq percent confirming: | 79.7111 |
| LEAP-Seq n confirming: | 7614 |
| LEAP-Seq n nonconfirming: | 1938 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGTCCTCGATCTTGTTGGG |
| Suggested primer 2: | AGCATACAAACGGTTGAGGG |