| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.044123 |
| Chromosome: | chromosome 7 |
| Location: | 646290 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g317100 | POB18 | Proteome of basal body 18 | 5'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCGCTATGTATGATAGGATTATAGGACA |
| Internal bar code: | AATCGTCCCAGCGGGGCAGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1 |
| LEAP-Seq percent confirming: | 99.619 |
| LEAP-Seq n confirming: | 1569 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCCTCAGAAACTGCATTG |
| Suggested primer 2: | GCACCAGCTTCTCGTAGTCC |