| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.044123 |
| Chromosome: | chromosome 11 |
| Location: | 2424949 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g475050 | (1 of 1) K17973 - N-terminal acetyltransferase B complex non-catalytic subunit (NAA25, MDM20) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCCGTGGTCTCGCACACGTATTCTACGC |
| Internal bar code: | CGCGCCCCTATCGCTCCCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 840 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 255 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCAAGCATGGTAGATTGGT |
| Suggested primer 2: | CTGAGGAGCTGACTTCGACC |