| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.044371 |
| Chromosome: | chromosome 7 |
| Location: | 3437478 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g335300 | KAS2 | (1 of 1) 2.3.1.179 - Beta-ketoacyl-[acyl-carrier-protein] synthase II / KASII; 3-ketoacyl-ACP-synthase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAGATGATCCCTTGCAACCCCTTGTCCAA |
| Internal bar code: | GTGTCACGGCAAAATCAACGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 301 |
| LEAP-Seq percent confirming: | 99.706 |
| LEAP-Seq n confirming: | 12889 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTACTGTGCGTAATGCTGGC |
| Suggested primer 2: | AGACATGTTGGTCCGTGTGA |