| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.044380 |
| Chromosome: | chromosome 14 |
| Location: | 431649 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g610750 | MAE16 | (1 of 11) K03327 - multidrug resistance protein, MATE family (TC.MATE, SLC47A, norM, mdtK, dinF); MATE efflux family protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGCAGTGGGTCTGGGGCGACCACGGGAG |
| Internal bar code: | CACATACCCGTGGCGACACAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 300 |
| LEAP-Seq percent confirming: | 32.9703 |
| LEAP-Seq n confirming: | 2573 |
| LEAP-Seq n nonconfirming: | 5231 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGGACAGTGGTAAGGCAG |
| Suggested primer 2: | CCAGCCCAAACTAAACCAAA |