Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.044413 |
Chromosome: | chromosome_9 |
Location: | 3667873 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre09.g390615 | FAP12 | Triacylglycerol lipase and Flagellar Associated Protein | sense | 5'UTR |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | GTTGATACATAACAGCTGTGCTGCGTTCAT |
Internal bar code: | TAGGGATACCATGCGGCGGACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1003 |
LEAP-Seq percent confirming: | 98.7776 |
LEAP-Seq n confirming: | 3798 |
LEAP-Seq n nonconfirming: | 47 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTCAGCTAATGCCTTGCGT |
Suggested primer 2: | GAAGAAAGGGAGCAGACGTG |