Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.044454 |
Chromosome: | chromosome 14 |
Location: | 1791700 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g619900 | PHX22,PFH22 | Putative prolyl 4-hydroxylase; (1 of 1) PTHR10869:SF80 - IRON ION BINDING / OXIDOREDUCTASE | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCAACCTGCAGCCCCTTCCAGCGTCGCC |
Internal bar code: | GAGACAACCGTCTGTTTTGCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 844 |
LEAP-Seq percent confirming: | 98.4311 |
LEAP-Seq n confirming: | 6211 |
LEAP-Seq n nonconfirming: | 99 |
LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCCCACACCTGTACACAC |
Suggested primer 2: | GAGCAGGGAGGCTTGTACTG |