| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.044487 |
| Chromosome: | chromosome 10 |
| Location: | 1517029 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g428950 | (1 of 1) PTHR11019//PTHR11019:SF97 - THIJ/PFPI // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGCCTTCTACGCCAACGACCCCGACTCC |
| Internal bar code: | GGCACAATTATTGGGTCCAGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1179 |
| LEAP-Seq percent confirming: | 99.1774 |
| LEAP-Seq n confirming: | 47504 |
| LEAP-Seq n nonconfirming: | 394 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACATGCTTACGTGGGTGA |
| Suggested primer 2: | ATATACAAGGCGTGCCCAAG |