| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.044542 |
| Chromosome: | chromosome 16 |
| Location: | 4723972 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g686950 | CTF18 | DNA damage repair and chromosome cohesion protein; (1 of 1) K11269 - chromosome transmission fidelity protein 18 (CTF18, CHL12) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCCGACCTTCCAGCCCCAGCTCACTGCC |
| Internal bar code: | GGGCATGGTTGCCCACGCGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 272 |
| LEAP-Seq percent confirming: | 99.8134 |
| LEAP-Seq n confirming: | 535 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCGTATCTGCTGGTTCCC |
| Suggested primer 2: | CGGTATGCGTGGTATGTGAG |