| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.044564 |
| Chromosome: | chromosome 3 |
| Location: | 4058834 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g172550 | PRM1,PRMT1 | (1 of 2) K11434 - protein arginine N-methyltransferase 1 (PRMT1); Protein-/Histone-arginine N-methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGCGGCTATTGCCCTCACAATACTGGT |
| Internal bar code: | TTTTTGTCTACTCGCTTGCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 924 |
| LEAP-Seq percent confirming: | 99.5878 |
| LEAP-Seq n confirming: | 1691 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGATAAGCCCGTGTGGAC |
| Suggested primer 2: | AAGAACACCCAGCAATACCG |