| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.044606 |
| Chromosome: | chromosome 9 |
| Location: | 6285285 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g406500 | (1 of 1) PF07814 - Wings apart-like protein regulation of heterochromatin (WAPL) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTACATGTCCAGTCCACAAGCATGGCTC |
| Internal bar code: | AAGTGCGGGGATAGCATTGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 629 |
| LEAP-Seq percent confirming: | 99.7167 |
| LEAP-Seq n confirming: | 14077 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACCCTCCACACACTCA |
| Suggested primer 2: | TGCCTGTCGATGTTATGGAG |