| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.044619 |
| Chromosome: | chromosome 3 |
| Location: | 3183262 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g165250 | (1 of 1) PF01248//PF12874 - Ribosomal protein L7Ae/L30e/S12e/Gadd45 family (Ribosomal_L7Ae) // Zinc-finger of C2H2 type (zf-met) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCGGAACGCCGGCACCCACCCACTCCGA |
| Internal bar code: | CGAACTGTTCCTCTTTGCGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 102 |
| LEAP-Seq percent confirming: | 99.7275 |
| LEAP-Seq n confirming: | 366 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAACAACGAATCGGAAGG |
| Suggested primer 2: | CTTCCCCTCTGAACCTCCTG |