| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.044665 |
| Chromosome: | chromosome 3 |
| Location: | 4646045 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g177400 | CYA2 | Solute-binding protein-like adenylate cyclase; (1 of 86) IPR001054//IPR029787 - Adenylyl cyclase class-3/4/guanylyl cyclase // Nucleotide cyclase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTCATAGCACTGGCGTTGTACATCCACG |
| Internal bar code: | TTTTGTGATATATTTCCGCGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 265 |
| LEAP-Seq percent confirming: | 99.7947 |
| LEAP-Seq n confirming: | 486 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCTTCCATTCCTGCATCAC |
| Suggested primer 2: | CTGTAGAGGAGCGGAACAGG |