Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.044677 |
Chromosome: | chromosome 8 |
Location: | 688932 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g360200 | DUR3,DUR3A | Urea active transporter; (1 of 3) PTHR11819:SF94 - SODIUM-DEPENDENT MULTIVITAMIN TRANSPORTER-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGAAGGAACTGCACTAGGGCTTGGCGTCA |
Internal bar code: | TGCCTTGACTGTCAATTGAAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 696 |
LEAP-Seq percent confirming: | 99.5928 |
LEAP-Seq n confirming: | 5381 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCACCTGGGGGAAGATGTAG |
Suggested primer 2: | ATGTTCCAGGTCTACGCCAC |