| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.044679 |
| Chromosome: | chromosome 3 |
| Location: | 5632052 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g187200 | LC6,ODA13,DLL2,ODA-LC6 | (1 of 2) K10418 - dynein light chain LC8-type (DYNLL); Outer Arm Dynein Light Chain 6 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAGTTGTAGGGCACTGAGATGAAGCCCG |
| Internal bar code: | TGGGCCAGCACAGTCGTCTTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 898 |
| LEAP-Seq percent confirming: | 99.2653 |
| LEAP-Seq n confirming: | 18644 |
| LEAP-Seq n nonconfirming: | 138 |
| LEAP-Seq n unique pos: | 98 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCTCCATGCGGATCTTACG |
| Suggested primer 2: | GACGTCCTGAAGCTCACTCC |