| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.044712 |
| Chromosome: | chromosome 17 |
| Location: | 1513347 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g707150 | LIC2 | Hypothetical protein; (1 of 45) IPR029052 - Metallo-dependent phosphatase-like | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGATATTCTGGGAGCATTCTGATAGTAGG |
| Internal bar code: | ATATCAAACCTAGCAGTTCGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 855 |
| LEAP-Seq percent confirming: | 96.4246 |
| LEAP-Seq n confirming: | 1726 |
| LEAP-Seq n nonconfirming: | 64 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCGAGGGTAAGAGGGAGAG |
| Suggested primer 2: | CCTACGACGTAAGGTCGCTC |